DNA is now being used to create a registry of all species on earth. This will help identify and track species and aid in their preservation. The Canadian idea and technology has been adopted by the UN.

DNA is now being used to create a registry of all species on earth. This will help identify and track species and aid in their preservation. The Canadian idea and technology has been adopted by the UN.
Photo Credit: via CBC

“Barcoding”: helping to identify and preserve the world’s biodiversity

Share

It began about 12 years ago when research Professor Paul Hebert proposed using short sections of DNA to identify species.

To simplify understanding, it’s being called barcoding of species, in that species can be identified through computer matching of the DNA codes, similar to the way product barcodes are read by store scanners.

The idea has been gaining momentum, and was among the recommendations this week to help identify and aid in preservation of species at the UN’s Biodiversity Conference in Cancun, Mexico.

Paul Hebert (O.C., PhD, FRSC) is the Director for the Centre of Biodiversity Genomics at the University of Guelph in Ontario.

Listen
Research professor Paul Hebert (O.C., PhD, FRSC) at the University of Guelph is the initiator of a global project to identify and register all the world’s species
Research professor Paul Hebert (O.C., PhD, FRSC) at the University of Guelph is the initiator of a global project to identify and register all the world’s species © University of Guelph

Professor Hebert proposed the idea in 2002 in a scientific paper to the Royal Society called “Biological Identification through DNA barcodes”

The idea was accepted among the recommendations this week as representatives from 196 countries attended the 13th conference of the Parties to the Convention on Biological Diversity (CBD).

This Canadian originated idea is now part of the United Nations strategic plan for enhancing and protecting biodiversity.

Malcolm Campbell, vice-president (research) at the university said, “Because of the visionary work of U of G researchers, DNA barcoding has changed the way we look at life on this planet. The UN’s recognition is a testament to its effectiveness and the important role it plays in protecting the world’s biodiversity.”

As professor Hebert points out, it would be impossible to track temperature and climate without instruments to measure, and this is an instrument to track species to determine, their extent and changes in biodiversity, their growth or decline and effects of environmental change.

Arctic Warbler and its actual *barcode* of DNA. If it was written down it would look like this, CCTATACCTAATCTTCGGAGCATGAGCGGGCATGGTAGGC
Arctic Warbler and its actual *barcode* of DNA. If it was written down it would look like this, CCTATACCTAATCTTCGGAGCATGAGCGGGCATGGTAGGC. © wiki commons/ BOLD

He also points out that determining the species in a lake can now simply be done not by catching specimens, but by simply taking a water sample and identifying the traces of DNA in it, from fish, to algae and so on.

In addition only a specific region of the DNA is needed, a short section known as C01. Because it is short, it is relatively quick and inexpensive to sequence yet provides enough information to clearly identify species.

A specimen is determined, tissue sample taken sampled in the lab and barcode created, Simultaneously the information about the specimen is noted, photographed and additiona information added. Together, that combined information becomes part of the registry.
A specimen is found, tissue sample taken, analyzed in the lab and barcode created, Simultaneously the information about the specimen is noted, photographed and additiona information added. Together, that combined information becomes part of the registry. © IBOL

Once a sample tissue or DNA is collected it is analyzed and sequenced. In written form the code is represented by a series of letters CATG representing the nucleic acids – cytosine, adenine, thymine and guanine.

Examples for other species barcodes, note how two very seimilar looking insects have different DNA
Examples for other species barcodes, note how two very similar looking insects are different species with different DNA

The registry project now involves scientists from around the world who constantly add and request information from the Guelph-based registry.

Additional information- sources

Share
Categories: Environment, International, Internet, Science and Technology
Tags: , , , , , , ,

Do you want to report an error or a typo? Click here!

@*@ Comments

Leave a Reply

Your email address will not be published. Required fields are marked *

 characters available

Note: By submitting your comments, you acknowledge that Radio Canada International has the right to reproduce, broadcast and publicize those comments or any part thereof in any manner whatsoever. Radio Canada International does not endorse any of the views posted. Your comments will be pre-moderated and published if they meet netiquette guidelines.

Netiquette »

When you express your personal opinion in an online forum, you must be as courteous as if you were speaking with someone face-to-face. Insults and personal attacks will not be tolerated. To disagree with an opinion, an idea or an event is one thing, but to show disrespect for other people is quite another. Great minds don’t always think alike—and that’s precisely what makes online dialogue so interesting and valuable.

Netiquette is the set of rules of conduct governing how you should behave when communicating via the Internet. Before you post a message to a blog or forum, it’s important to read and understand these rules. Otherwise, you may be banned from posting.

  1. RCInet.ca’s online forums are not anonymous. Users must register, and give their full name and place of residence, which are displayed alongside each of their comments. RCInet.ca reserves the right not to publish comments if there is any doubt as to the identity of their author.
  2. Assuming the identity of another person with intent to mislead or cause harm is a serious infraction that may result in the offender being banned.
  3. RCInet.ca’s online forums are open to everyone, without regard to age, ethnic origin, religion, gender or sexual orientation.
  4. Comments that are defamatory, hateful, racist, xenophobic, sexist, or that disparage an ethnic origin, religious affiliation or age group will not be published.
  5. In online speak, writing in ALL CAPS is considered yelling, and may be interpreted as aggressive behaviour, which is unpleasant for the people reading. Any message containing one or more words in all caps (except for initialisms and acronyms) will be rejected, as will any message containing one or more words in bold, italic or underlined characters.
  6. Use of vulgar, obscene or objectionable language is prohibited. Forums are public places and your comments could offend some users. People who use inappropriate language will be banned.
  7. Mutual respect is essential among users. Insulting, threatening or harassing another user is prohibited. You can express your disagreement with an idea without attacking anyone.
  8. Exchanging arguments and opposing views is a key component of healthy debate, but it should not turn into a dialogue or private discussion between two users who address each other without regard for the other participants. Messages of this type will not be posted.
  9. Radio Canada International publishes contents in five languages. The language used in the forums has to be the same as the contents we publish. The usage of other languages, with the exception of some words, is forbidden. Messages that are off-topic will not be published.
  10. Making repetitive posts disrupts the flow of discussions and will not be tolerated.
  11. Adding images or any other type of file to comments is forbidden. Including hyperlinks to other websites is allowed, as long as they comply with netiquette. Radio Canada International  is in no way responsible for the content of such sites, however.
  12. Copying and pasting text written by someone else, even if you credit the author, is unacceptable if that text makes up the majority of your comment.
  13. Posting any type of advertising or call to action, in any form, to Radio Canada International  forums is prohibited.
  14. All comments and other types of content are moderated before publication. Radio Canada International  reserves the right to refuse any comment for publication.
  15. Radio Canada International  reserves the right to close a forum at any time, without notice.
  16. Radio Canada International  reserves the right to amend this code of conduct (netiquette) at any time, without notice.
  17. By participating in its online forums, you allow Radio Canada International to publish your comments on the web for an indefinite time. This also implies that these messages will be indexed by Internet search engines.
  18. Radio Canada International has no obligation to remove your messages from the web if one day you request it. We invite you to carefully consider your comments and the consequences of their posting.

*

One comment on ““Barcoding”: helping to identify and preserve the world’s biodiversity
  1. Avatar Shelley Ottenbrite says:

    There is something creepy about arguing from commerciaI products.

    The Iibrary anaIogy is so much IoveIier.